Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_000598 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Osteoarthritis (OA) | ICD-10 | Polyarthrosis, unspecified (M15.9) |
DBLink | Link to database | PMID | 28624198 |
Experimental Method | |||
Sample Type | Cartilage | Comparison | OA cartilage was isolated from the knee joints of 30 patients undergoing total knee arthroplasty |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GTCCCTTCCCTGTCACTACCT ReverseTCTGTTGATGCCGCCTTGG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Liu, Q, Zhang, X, Hu, X, Yuan, L, Cheng, J, Jiang, Y, Ao, Y (2017). Emerging Roles of circRNA Related to the Mechanical Stress in Human Cartilage Degradation of Osteoarthritis. Mol Ther Nucleic Acids, 7:223-230. |